Review



gene knockdown c2c12 myoblasts  (Genecopoeia)


Bioz Verified Symbol Genecopoeia is a verified supplier
Bioz Manufacturer Symbol Genecopoeia manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Genecopoeia gene knockdown c2c12 myoblasts
    Gene Knockdown C2c12 Myoblasts, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+knockdown+c2c12+myoblasts/Human+cell+line+C2C12+stably+expressing+CRISPR+Cas9%2C+randomly+inserted%2C+single+clone/pm39823152-218-9-29
    Average 94 stars, based on 16 article reviews
    gene knockdown c2c12 myoblasts - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Effects of HMG CoA reductase (HMGCR) deficiency on skeletal muscle development.
    Article Snippet: To induce differentiation, the cells were then cultured in low serum medium supplemented with DMEM +2% horse serum (Gibco). .. The differentiation medium was replenished every 48 h. shRNA-mediated gene knockdown C2C12 myoblasts were transfected with either a cocktail of three different shRNAs targeting mouse-Hmgcr or scrambled shRNA control (GeneCopoeia, Rockville, MD, USA) using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific, Waltham, MA, USA). .. The three shRNAs target the following sequences on mouse Hmgcr—NM_008255.2: Hmgcr (1)—GGTTGACGTAAACATTAACAA Hmgcr (2)—GGAAACTCTAATGGAAACTCA Hmgcr (3)—GGACATTGAGCAAGTGATTAC Stable cells expressing GFP reporter were selected using puromycin 3 lg mL 1 (Sigma—P8833, MilliporeSigma, Burlington, MA, USA).

    Knockdown:

    Article Title: Effects of HMG CoA reductase (HMGCR) deficiency on skeletal muscle development.
    Article Snippet: To induce differentiation, the cells were then cultured in low serum medium supplemented with DMEM +2% horse serum (Gibco). .. The differentiation medium was replenished every 48 h. shRNA-mediated gene knockdown C2C12 myoblasts were transfected with either a cocktail of three different shRNAs targeting mouse-Hmgcr or scrambled shRNA control (GeneCopoeia, Rockville, MD, USA) using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific, Waltham, MA, USA). .. The three shRNAs target the following sequences on mouse Hmgcr—NM_008255.2: Hmgcr (1)—GGTTGACGTAAACATTAACAA Hmgcr (2)—GGAAACTCTAATGGAAACTCA Hmgcr (3)—GGACATTGAGCAAGTGATTAC Stable cells expressing GFP reporter were selected using puromycin 3 lg mL 1 (Sigma—P8833, MilliporeSigma, Burlington, MA, USA).

    Transfection:

    Article Title: Effects of HMG CoA reductase (HMGCR) deficiency on skeletal muscle development.
    Article Snippet: To induce differentiation, the cells were then cultured in low serum medium supplemented with DMEM +2% horse serum (Gibco). .. The differentiation medium was replenished every 48 h. shRNA-mediated gene knockdown C2C12 myoblasts were transfected with either a cocktail of three different shRNAs targeting mouse-Hmgcr or scrambled shRNA control (GeneCopoeia, Rockville, MD, USA) using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific, Waltham, MA, USA). .. The three shRNAs target the following sequences on mouse Hmgcr—NM_008255.2: Hmgcr (1)—GGTTGACGTAAACATTAACAA Hmgcr (2)—GGAAACTCTAATGGAAACTCA Hmgcr (3)—GGACATTGAGCAAGTGATTAC Stable cells expressing GFP reporter were selected using puromycin 3 lg mL 1 (Sigma—P8833, MilliporeSigma, Burlington, MA, USA).

    Control:

    Article Title: Effects of HMG CoA reductase (HMGCR) deficiency on skeletal muscle development.
    Article Snippet: To induce differentiation, the cells were then cultured in low serum medium supplemented with DMEM +2% horse serum (Gibco). .. The differentiation medium was replenished every 48 h. shRNA-mediated gene knockdown C2C12 myoblasts were transfected with either a cocktail of three different shRNAs targeting mouse-Hmgcr or scrambled shRNA control (GeneCopoeia, Rockville, MD, USA) using Lipofectamine 3000 (Invitrogen, ThermoFisher Scientific, Waltham, MA, USA). .. The three shRNAs target the following sequences on mouse Hmgcr—NM_008255.2: Hmgcr (1)—GGTTGACGTAAACATTAACAA Hmgcr (2)—GGAAACTCTAATGGAAACTCA Hmgcr (3)—GGACATTGAGCAAGTGATTAC Stable cells expressing GFP reporter were selected using puromycin 3 lg mL 1 (Sigma—P8833, MilliporeSigma, Burlington, MA, USA).



    Similar Products

    gene knockdown c2c12 myoblasts  (Genecopoeia)
    94
    Genecopoeia gene knockdown c2c12 myoblasts
    Gene Knockdown C2c12 Myoblasts, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gene+knockdown+c2c12+myoblasts/Human+cell+line+C2C12+stably+expressing+CRISPR+Cas9%2C+randomly+inserted%2C+single+clone/pm39823152-218-9-29
    Average 94 stars, based on 1 article reviews
    gene knockdown c2c12 myoblasts - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results